                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:158 nt.     Distance to run of Ts=1 nt.   Size=24 nt.     Delta G= -7.30 kcal/mol
Antiterminator: Size=38 nt.     Delta G=-10.10 kcal/mol
Anti-antiterminator:   Size=32 nt.     Delta G=-10.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

agatgcaatgacaactgacaaattatgaaagatttcagcagcttcgctgcattgctggcaatggtttcggcttctcctgtctgttgccccttcaatatag
ggtgtgaaagccggcgttgcgataatgcaacatcgcatttttgccatcttctcgacaggttatctccacacaacggggcatttcgtgccgcaattaccct
cgatatgtcacccctgtcagcgcggcatgggcggttcactcccgatgctgcccgcccgataagggaccgcgcaaaacgtaatttgtgtaaggagaatgcc
ATG

    BR0701 Gene: BR0701     GI: 23501588     BI number: BR0701     GOG: COG3637     Description: outer-membrane protein, 25 kD             a           a  t           c  a tc       t  t t  t       ta c  c       cg gc        cg gt        cg cg       |  t       ta t  t       cg       a  a t  |       gt       g  t t  |       tg        cg gc        ta        gc gt       g  a       ta tg        ta        ta at        cg        gc at       t  c      c  a cg        gc       g  t gc        tg        gc gc        cg        cg                         catttttgccatcttctcgacaggttatctccacacaacggggcatttcgtgccgcaattaccctcgatatgtcacccctgtcagcgcggcatgggcggttcactcccgatgctgcccgcccgataagggaccgcgcaaaacgtaatttgtgtaaggagaatgccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG3637 Opacity protein and related surface antigens ... can be seen here     ..................................................................................................................