Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:33 nt.    Distance to gene:183 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G= -9.30 kcal/mol
Antiterminator:    Distance from promoter:12 nt. Size=30 nt.     Delta G= -7.30 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G=-16.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaca-accaat. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacatgaatgtcaccgttgcgaccaatcgtttccgaTTGGCGAATGGTTTTGGTGACAGTCTGGCGCGCGGG
CGTCGGTTTCTTGACCATGATGATCCATTCTATGCAGATTTGCCGTTAGAGCGGTTCC
TGTTTTAAcaaaatcgccggaaccgttctggagcccgaaccaaaagcatcatttgcacaccagcatggcggcttttggaacaggctataggtcc
gtgcggagtttaagatcgagttaccgccgcgcaggatacaaTTG

    BR0711


Gene: BR0711     GI: 23501598     BI number: BR0711     GOG: -------     Description: hypothetical protei


 tt
t  c
 gc
 cg        TG
 ta       G  A
 aT        GC
 aT        TA
 cG        TG
 cG       T  T
a  |      T  |
 gC        GC        CG
 cG        GT       G  G
g  |       TG        CG
 tA       |  G       GC
 tA       A  C       CG
 gT       A  G       GT
 cG        GC        GC
 cG        CG        TG
 aT        GC        CG
                        TTTCTTGACCATGATGATCCATTCTATGCAGATTTGCCGTTAGAGCGGTTCCTGTTTTAAcaaaatcgccggaaccgttctggagcccgaaccaaaagcatcatttgcacaccagcatggcggcttttggaacaggctataggtccgtgcggagtttaagatcgagttaccgccgcgcaggatacaaTTG


    ..................................................................................................................