Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:112 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G=-12.70 kcal/mol
Antiterminator: Size=70 nt.     Delta G=-10.64 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCCGATGAGCTATATCGCCGTCATGAACGTGAGTGGGCCGAATTCCGCAATGCGGTT
GAAGCAAGTGAAACAAACCAGAAGCAGCAAGGGCAGGCTTCCGGCAAAACTTCCTGTG
ACAGCAAAACCGGAAATCAATAAtctatccgtttgcctctttgcaaaacgccgcttcaagcggcgttttttattgcctgttcg
ccaaggctggcaaaatcttatcttcaacaaaattgacttgggctttcagggcgatccgctaactttatcacatcaaaccattgggaacagggcctggaag
cATG

    BR0717


Gene: BR0717     GI: 23501604     BI number: BR0717     GOG: COG1028     Description: oxidoreductase, short-chain dehydrogenase/reductase famil


  T
A  A
A  A
C  t
T  c
A  t
A  a
 At
 Gc
 Gc
 Cg
C  |
A  |
 At
 At
 At
 Cg
 Gc
|  c
|  t
A  c
C  t
 At
 Gt
 Tg
 Gc
 Ta
C  a
C  a
T  a
T  c        c
C  |      t  a
A  |      t  a
A  |       cg
A  |       gc
A  |       cg
 Cg        cg
 Gc        gc
 Gc        cg
 Cg        at
            tttttattgcctgttcgccaaggctggcaaaatcttatcttcaacaaaattgacttgggctttcagggcgatccgctaactttatcacatcaaaccattgggaacagggcctggaagcATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[IQR] COG1028 Dehydrogenases with different specificities (related to short-chain alcohol dehydrogenases) ... can be seen here

    ..................................................................................................................