Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:181 nt.     Distance to run of Ts=0 nt.   Size=17 nt.     Delta G= -8.30 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-11.92 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ccggtgatagcgcatgttggagatagggtggaatgctgactgacgggttatctaaatgaacccgccaaagctgtcctctcgcgagagtaccgtacaccgg
cagcgaagcgctgtctttttcgcgtttaggccgcgcgtgacgctttttttacagcccgcatgggggagatgtgctggtcaaactaaatcgtcgagtggca
aagaatcaccacttttggtagcgatgcgacgggttaggacttagagcgaaaagtgaattttggggggactttgaaagcgaacattctatcaaccctctcg
GTG

    BR0734


Gene: BR0734     GI: 23501621     BI number: BR0734     GOG: NOG10806     Description: conserved hypothetical protei



 cg
g  a
 cg
 ta
 cg
|  t
|  a
|  c
|  c
|  g
|  t
|  a
|  c
|  a
t  c
c  c
 cg
 tg
 gc
 ta         a
 cg       a  g
 gc        gc
a  g       cg
a  a       gc
a  a       at
c  |       cg
 cg        gt
 gc        gc
            tttttcgcgtttaggccgcgcgtgacgctttttttacagcccgcatgggggagatgtgctggtcaaactaaatcgtcgagtggcaaagaatcaccacttttggtagcgatgcgacgggttaggacttagagcgaaaagtgaattttggggggactttgaaagcgaacattctatcaaccctctcgGTG


    ..................................................................................................................