                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:37 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-20.50 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -4.72 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G= -8.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCTCAAGAATACGCCGGGCTGGGACCGCCAGAACATTGAAGCCACGATCAAGTCGGGC
GTCAATACGCCGATCCAGCTTGCCGATCCGGTTCCGCTGCACTTCGTCTATATCAGTG
CCTGGTCCACGGGTGACGGTGTGGTGCAGTTCCGCGATGATATCTACAAGATGGATGG
CTCAACCGAACTGGCGCTTGGCACGGACACCTGAttgcgTCAAAAACCACCTGTTGCAAG
CCGCCCGGATGCCATGCCGGGCGGCTTTTTGCTTGTGCGGCATTTATCAAATCGGTTT
GCCGCATTTTG

    BR0764 --- glyA Gene: BR0764     GI: 23501651     BI number: BR0764     GOG: -------     Description: hypothetical protein Gene: glyA     GI: 23501652     BI number: BR0765     GOG: COG0112     Description: serine hydroxymethyltransferas             C           A  C           A  A           A  C           A  C            AT            CG   C       T  T A  A       gT GC        cG GC        gC C  |       tA        CC AT        tA       G  A CG       A  G      T  T G  A      G  C      A  G G  t      T  C       GC T  t      C  G       GC T  |      C  C       CG Cg       A  |       CG Gc       C  |       CG Cg       A  |       GC GT        GC        CG GC        GC        CG TA        CG        GC                         TTTTTGCTTGTGCGGCATTTATCAAATCGGTTTGCCGCATTTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0112 Glycine/serine hydroxymethyltransferase ... can be seen here     ..................................................................................................................