Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:186 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-18.50 kcal/mol

                                                                        Nomenclature/Definitions

TGAAGGAAAAGGTCATCGCCCTGACCGGCCGTTTCCCGATGTACGGCTATCAGGGATA
Agtccgctttcgtaataccgatgaaaccccgttcaacgctgttggacggggttttttacaccgctttgtgattgtcgcatccggtaggtggaatgccgct
tataggttatgatcgccgggaatcggttgcgggaataaggctcttgcgtttgtatcgggggcgatcccacatatgagcagcccgtcgccagtgttgaagt
cgccgatattgagattgccaatattgaaattgaaagagttcgATG

    BR0766 --- ribD --- ribE


Gene: BR0766     GI: 23501653     BI number: BR0766     GOG: COG1327     Description: conserved hypothetical protein TIGR00244
Gene: ribD     GI: 23501654     BI number: BR0767     GOG: COG0117,COG1985     Description: riboflavin biosynthesis protein RibD
Gene: ribE     GI: 23501655     BI number: BR0768     GOG: COG0307     Description: riboflavin synthase, alpha subuni


           c
         g  t
          cg
          at
          at
          cg
          tg
          ta
          gc
          cg
          cg
          cg
          cg
          at
            tttttacaccgctttgtgattgtcgcatccggtaggtggaatgccgcttataggttatgatcgccgggaatcggttgcgggaataaggctcttgcgtttgtatcgggggcgatcccacatatgagcagcccgtcgccagtgttgaagtcgccgatattgagattgccaatattgaaattgaaagagttcgATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[K] COG1327 Predicted transcriptional regulator, consists of a Zn-ribbon and ATP-cone domains ... can be seen here
[H] COG0117 Pyrimidine deaminase ... can be seen here
[H] COG1985 Pyrimidine reductase, riboflavin biosynthesis ... can be seen here
[H] COG0307 Riboflavin synthase alpha chain ... can be seen here

    ..................................................................................................................