Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:133 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G= -7.82 kcal/mol
Antiterminator: Size=77 nt.     Delta G=-38.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gcggttacaagacaagttcacgcgacaagccgccgcgttttaacctttcatcatcgtggctcacgagctagtggtctgattccaacatttgcatccctcg
gttcaagcgttgatcaaatgttggaatcacaaagaccactagtaagtatatgtatctagtggatttttagaatttgacgtttgaaacagcatatgtaaca
gccgggattcaaacgtcaaattcaatccactagagcatttccagtatttcaaataaaacgggaaaagctcgactgatgactggcgaaaaggaaaagcacc
ATG

    BR0786


Gene: BR0786     GI: 23501673     BI number: BR0786     GOG: NOG09779     Description: conserved hypothetical protei


  c
t  a
t  a
g  g
 gc
 cg
t  t
c  t
c  |
 cg
 ta
 at
c  |
 gc
 ta
 ta
 ta
 at
 cg
 at
 at
 cg
 cg
 ta
 ta
 at
 gc
|  a
|  c        t
|  a      a  a
|  a      t  t
 ta       g  g
 cg       a  t
 ta       a  a
 gc       t  t
 gc        gc
 ta        at
 gc        ta
 at        cg
 ta        at
 cg        cg
 gt        cg
            atttttagaatttgacgtttgaaacagcatatgtaacagccgggattcaaacgtcaaattcaatccactagagcatttccagtatttcaaataaaacgggaaaagctcgactgatgactggcgaaaaggaaaagcaccATG
    ..................................................................................................................