                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:40 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-17.20 kcal/mol
Antiterminator: Size=49 nt.     Delta G=-10.00 kcal/mol
Anti-antiterminator:   Size=30 nt.     Delta G= -7.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GACATCGTTGCCACCGTTGCCGGTGGTGGTCTCTCCGGTCAGGCCGGTGCCGTTCGTC
ACGGCATTTCCAAGGCCCTCACCTACTACGAACCGGGCCTGCGCACGGTTCTCAAGAA
GGGTGGCTTCCTGACCCGCGACAGCCGCGTCGTCGAACGTAAGAAGTATGGTAAGGCC
AAGGCCCGCCGCAGCTTCCAGTTCTCGAAGCGTTAAtccttatcgctttggacttacagaaaagcgggccttc
gggtccgcttttttgctatgtaataggagactcaagccagcacggaagcggccATG

    BR0789 Gene: BR0789     GI: 23501676     BI number: BR0789     GOG: COG0010     Description: agmatinase, putativ             t           t  a           c  c           a  a           g  g           g  a            ta            ta            ta            cg            gc            cg            tg           a  |   c       t  | t  c      t  | At       c  | At       c  | Ta       t  | T  t      A  | Gc       A  |       tc Cg       T  |      t  g Gc        Tg        cg At        Gc        cg At       C  |       gt Gt        Gc        gc Cg        At        gc T  |       At        cg Cg        Gc        gc Ta        Cg        at                         tttttgctatgtaataggagactcaagccagcacggaagcggccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0010 Arginase/agmatinase/formimionoglutamate hydrolase, arginase family ... can be seen here     ..................................................................................................................