                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:177 nt.     Distance to run of Ts=1 nt.   Size=32 nt.     Delta G= -9.90 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -5.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAACCTGCCTTATGCGGATTTGCGAATAAatttgtgtcgtaacttgcggaagttcatagaaaaatccaaatcatccttt
cagatcggttccggttaaaacgaggtcgatggagccgctttctttctttgtttgtacgcattatccgacgtatcgaagcgggatcagaaatcagtccagt
ggactgattttccagcgtagacgcttcgcacttttgctggaaatgctctagactgaactgcttttatcgattcaacagctctgcttgacagcggcagagt
ttttccagaaggaaacggggcATG

    BR0827 Gene: BR0827     GI: 23501714     BI number: BR0827     GOG: -------     Description: hypothetical protei            gg           a  t            gc tt        cg g  c      a  a gc       a  | cg       a  | tg       a  | at       t  | gt       t  | |  a      g  | |  a       gt a  a       cg c  a       cg t  c       ta tg        tg ta        gc cg        gc cg        cg             ctttctttctttgtttgtacgcattatccgacgtatcgaagcgggatcagaaatcagtccagtggactgattttccagcgtagacgcttcgcacttttgctggaaatgctctagactgaactgcttttatcgattcaacagctctgcttgacagcggcagagtttttccagaaggaaacggggcATG     ..................................................................................................................