                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:61 nt.    Distance to gene:166 nt.     Distance to run of Ts=1 nt.   Size=28 nt.     Delta G= -8.20 kcal/mol
Antiterminator:    Distance from promoter:18 nt. Size=58 nt.     Delta G=-30.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGCCA-ttaatt. It has a score value of 67.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGCCACCAAGGCAGCTTGAggcttaattgcctcataacacggccttagcctcgatttttataaaaggcgccgttcagcggcgcc
ttttatattgtcagatggtttTCATCGACGGTGGTTTTCTGCCGGGTCTTCGTTTTCGGGAGCGTCC
TCGGCAATTGGTCGGAATGTGTAAAAACAAATAATCAGAGCGGCTGCGCGCACAAAGG
TCCGGCAAGCCGCTCTGGGATCTTTATTCCGCGCTGCACCTTTCTGAGGCGGCGCACC
AATATGCCAGGGAATGCCAGCCATG

    BR0833 Gene: BR0833     GI: 23501720     BI number: BR0833     GOG: COG0477     Description: drug resistance transporter, Bcr/CflA famil   c t  a t  g gc cg cg gc cg gc gc at at at at ta at ta         t t  t      t  t t  t      g  T t  |       gC tg        tA at        aT gc        gC |  a      a  | cg        cG ta        tA |  t       gC cg        tG cg        tG gt        aT at        tG             GTTTTCTGCCGGGTCTTCGTTTTCGGGAGCGTCCTCGGCAATTGGTCGGAATGTGTAAAAACAAATAATCAGAGCGGCTGCGCGCACAAAGGTCCGGCAAGCCGCTCTGGGATCTTTATTCCGCGCTGCACCTTTCTGAGGCGGCGCACCAATATGCCAGGGAATGCCAGCCATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_suis_1330_I                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:201 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G=-14.80 kcal/mol Antiterminator: Size=35 nt.     Delta G= -9.70 kcal/mol Anti-antiterminator:   Size=39 nt.     Delta G=-13.90 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GAAAAAGGTATTGCCACCAAGGCAGCTTGAggcttaattgcctcataacacggccttagcctcgatttttataaaagg cgccgttcagcggcgccttttatattgtcagatggtttTCATCGACGGTGGTTTTCTGCCGGGTCTTCGTTTTC GGGAGCGTCCTCGGCAATTGGTCGGAATGTGTAAAAACAAATAATCAGAGCGGCTGCG CGCACAAAGGTCCGGCAAGCCGCTCTGGGATCTTTATTCCGCGCTGCACCTTTCTGAG GCGGCGCACCAATATGCCAGGGAATGCCAGCCATG     BR0833 Gene: BR0833     GI: 23501720     BI number: BR0833     GOG: COG0477     Description: drug resistance transporter, Bcr/CflA famil   a t  a       tt a  c      t  t c  a       ta t  c       at cg       |  a cg       g  a gc       c  a t  c       ta t  t       cg a  t       cg a  |       gc         c t  |      a  |      t  a ta       t  |      t  g cg       t  |       gc gc       c  |       cg gc        cg        cg At        gc        gc Gc        gc        cg Tg        cg        gc Ta        at        gc                         ttttatattgtcagatggtttTCATCGACGGTGGTTTTCTGCCGGGTCTTCGTTTTCGGGAGCGTCCTCGGCAATTGGTCGGAATGTGTAAAAACAAATAATCAGAGCGGCTGCGCGCACAAAGGTCCGGCAAGCCGCTCTGGGATCTTTATTCCGCGCTGCACCTTTCTGAGGCGGCGCACCAATATGCCAGGGAATGCCAGCCATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here     ..................................................................................................................