                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:200 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-16.10 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -8.30 kcal/mol
Anti-antiterminator:   Size=14 nt.     Delta G= -4.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGATGACGGCCGGGCGCTTTTTGCAGGCGCACTCGGCATCACAGCCTGAcagatcttgcatata
tgaaaacgggcggcccaatcggagccgccttttttattgcgcctgcttcatctcaaaactgcactggcaaagcatctgttttcatggcagcttggcttcg
ggcgggttccaacggaagaaaaaatgccgggatcgacccatatttgtttcacgcattctcccggcataaagagttcacatttttgctggaaatgcctcgc
atattttggcgacaacgaatcaggggaacatcattcATG

    BR0839 --- BR0838 Gene: BR0839     GI: 23501726     BI number: BR0839     GOG: COG0625     Description: glutathione S-transferase family protein Gene: BR0838     GI: 23501725     BI number: BR0838     GOG: NOG07157     Description: lipoprotein, putativ            at           c  a           g  t           t  a           t  t            cg            ta           a  a           g  a           a  a           c  |           A  |            Gc            Tg            Cg        at            Cg       a  c            Gc        cg           A  g       cg           C  |      |  a CA       A  |       cg T  C      C  |       gc A  A      T  |       gc CG       A  |       cg GC        Cg        gc GC        Gc        gc GT        Gc        gt                         tttttattgcgcctgcttcatctcaaaactgcactggcaaagcatctgttttcatggcagcttggcttcgggcgggttccaacggaagaaaaaatgccgggatcgacccatatttgtttcacgcattctcccggcataaagagttcacatttttgctggaaatgcctcgcatattttggcgacaacgaatcaggggaacatcattcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0625 Glutathione S-transferase ... can be seen here     ..................................................................................................................