                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:64 nt.     Distance to run of Ts=3 nt.   Size=27 nt.     Delta G= -8.80 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-10.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGCATTTCCGCGTCCCGCGCCTTGAGGCCAATACGGGCCACACGCACCGGCGTCGTCA
TtgcaaacggcacaggtgcggcggacggcagggcctcgtcagcggcccccgcaGTGCCAGGCGCCTTGCGTCTGCTGATT
GCCATCGGTGTTGTCTCCATCACGTTTCAGTTCTTGGTCGCGTTTCCGTTCTCGCACG
AAAGCGGTTTCGATTAAaacggaaccactctatttctttgtctttacgcattatcccacgcaaaccgcttcgcgcttttgccggaagt
gctctaaagatcgtgaTTG

    BR0846 --- BR0845 Gene: BR0846     GI: 23501733     BI number: BR0846     GOG: -------     Description: hypothetical protein Gene: BR0845     GI: 23501732     BI number: BR0845     GOG: COG3545     Description: conserved hypothetical protei CA G  C CG TA C  A TA TG GC         A CG       T  A CG       T  a T  T      A  a T  T       Gc T  T       Cg G  |       Tg C  |       Ta GC        Ta CG        Gc TA        Gc GT       C  a GT        Gc TA        At             ctatttctttgtctttacgcattatcccacgcaaaccgcttcgcgcttttgccggaagtgctctaaagatcgtgaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG3545 Predicted esterase of the alpha/beta hydrolase fold ... can be seen here     ..................................................................................................................