                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:123 nt.     Distance to run of Ts=0 nt.   Size=15 nt.     Delta G= -6.70 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-18.40 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G= -7.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCTTTGCGGTCAAAGGCCCGTTGGAGATAGTGAGGCGGTGGACCACCTGCCCGTCCGG
CGCATAGCCGAAGATTTCCGAATTCACgattgcctgcctgtaagccgtccagagataaacgcatcaagccgcatcgcagc
gcgccgcgcaagaggcgttgcggatattgtccgcttttttccgaattacctgccctgccgaggccgttgggaacacccctattcccttgccggagcgccg
tgctaccatacacgtataggtagtattcaataatttatcaaaatctaaagtaggggcaaattATG

    BR0856 Gene: BR0856     GI: 23501743     BI number: BR0856     GOG: COG3926     Description: conserved hypothetical protei ag g  a a  t c  a c  a ta         c gc       g  c cg        cg |  c       gc |  a       cg |  t       gc |  c      |  a |  a      |  a |  a      |  g cg       |  a gc       a  g a  c       cg a  |       gc tg        cg gc       t  t ta        at |  t       cg c  c       gc cg        cg         t gc        cg       a  t ta       |  a       tg cg       |  t       at |  c      g  a       gc cg        at        gc gc        at        cg tg        cg        gc                         ttttttccgaattacctgccctgccgaggccgttgggaacacccctattcccttgccggagcgccgtgctaccatacacgtataggtagtattcaataatttatcaaaatctaaagtaggggcaaattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG3926 Putative secretion activating protein ... can be seen here     ..................................................................................................................