                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:131 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-25.10 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -9.80 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G= -6.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

actggtcgaaaagttcaacgctgccatcaaggctattcgcaagaatggcaagtataaggaaatcaacgacaaatactttgatttcgacgcttacggcgct
gaaaactgataattgtcttatgggattgcgccagtctgctacaggcagactggcgcttttttgcgtttttagaatcccgttgtggcttgatgtatgttag
atacgcgccaatcatccgtgccatcggtacaactttcctgttgtacgccgcatcgaaacgaatgcgagaggcggcaaaagttcaattaagcagttaataa
ATG

    BR0863 Gene: BR0863     GI: 23501749     BI number: BR0863     GOG: COG0042     Description: TIM-barrel protein, yjbN famil   a t  c t  g cg gc         g cg       t  t a  c      t  c gt        at cg        at ta        ta ta        at         c ta       g  g      a  a a  a       tg       t  g g  c       cg        cg t  t      a  a       gc tg       a  t       ta ta       a  t       cg c  |      a  |       ta at       g  |       gc ta       t  |       at a  a       cg        cg at        gc        cg at        cg        gc cg        gc        cg at        gc        gc                         ttttttgcgtttttagaatcccgttgtggcttgatgtatgttagatacgcgccaatcatccgtgccatcggtacaactttcctgttgtacgccgcatcgaaacgaatgcgagaggcggcaaaagttcaattaagcagttaataaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0042 tRNA-dihydrouridine synthase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_suis_1330_I                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:139 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-25.10 kcal/mol Antiterminator: Size=38 nt.     Delta G= -9.80 kcal/mol Anti-antiterminator:   Size=54 nt.     Delta G= -8.10 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case actggtcgaaaagttcaacgctgccatcaaggctattcgcaagaatggcaagtataaggaaatcaacgacaaatactttgatttcgacgcttacggcgct gaaaactgataattgtcttatgggattgcgccagtctgctacaggcagactggcgcttttttgcgtttttagaatcccgttgtggcttgatgtatgttag atacgcgccaatcatccgtgccatcggtacaactttcctgttgtacgccgcatcgaaacgaatgcgagaggcggcaaaagttcaattaagcagttaataa ATG     BR0863 Gene: BR0863     GI: 23501749     BI number: BR0863     GOG: COG0042     Description: TIM-barrel protein, yjbN famil   a a  a c  t a  a g  c c  t at at cg         t ta       t  g at       a  t at        ac at        tt gc        at |  g       ga         c |  a      t  t      a  a g  c       cg       t  g a  g       ag        cg a  c      a  g       gc t  t      a  a       ta at       a  t       cg ta       g  |       ta gc       t  |       gc |  g      c  |       at a  g       gt        cg a  c       cg        cg cg        gc        gc gc        gg        cg gt        cc        gc                         ttttttgcgtttttagaatcccgttgtggcttgatgtatgttagatacgcgccaatcatccgtgccatcggtacaactttcctgttgtacgccgcatcgaaacgaatgcgagaggcggcaaaagttcaattaagcagttaataaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0042 tRNA-dihydrouridine synthase ... can be seen here     ..................................................................................................................