Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:72 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-25.60 kcal/mol
Antiterminator: Size=65 nt.     Delta G=-18.70 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-21.46 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGACATCCCGTTCGTCGCCCGTCAGGCCAAAGCGCGCTAAtcacaagtttctcgctaatcacaagtttc
tccgggcctggttcctcctcccaattcaggcccggttcgtcgcaaagctctccacctcctcccaggctttgcgataacaagaccggttctcctcccaatg
ccggtcttcccctaatggcatccgtcgccctcctcccgcgacggatgccatttctttttgcatctcccttcccggtttctggtcccttctcccattgaag
gcgctgatcaaaggcgataagggaattgccATG

    BR0894


Gene: BR0894     GI: 23501780     BI number: BR0894     GOG: COG1206     Description: gid protein, putativ


           tc
          c  c
          c  c
          t  a
          c  a
          t  t
           tg
  t        gc
c  c       gc
c  c       cg
a  t       cg
c  c       at
c  c       gc
t  c       at
c  a      |  t
 tg       |  c
 cg       |  c
 gc       |  c
 at       |  c        c
 at       |  t      c  t
 at       |  a      t  c
 cg       |  a      c  c
 gc        at       c  c
 cg        cg        cg
 ta       a  g       gc
 gt       a  c       cg
|  a       ta        ta
|  a       at        gc
|  c       gc        cg
|  a      c  |       cg
c  a       gc        ta
 tg        tg        at
 ta       t  t       cg
 gc       t  c       gc
 gc        cg        gc
 cg        gc        ta
 cg        gc        at
                        ttctttttgcatctcccttcccggtttctggtcccttctcccattgaaggcgctgatcaaaggcgataagggaattgccATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[J] COG1206 NAD(FAD)-utilizing enzyme possibly involved in translation ... can be seen here

    ..................................................................................................................