                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:132 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -9.50 kcal/mol
Antiterminator: Size=63 nt.     Delta G= -8.86 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G=-11.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tgctaatcgggcgcctgtGCCCTTATAGCTCAGTTGGTAGAGCACCTGATTTGTAATCAGGGGGT
CGGGAGTTCGAGTCTCTCTGGGGGCACCActtttcgacagatagcgtatataatcggtctttttacattggtatcgtca
cctctataatgagaggcggctttttaatcccgctctcgatatcgttttccgatattgtcgtaatacgcagcttataaattatcactcacttttacattta
ccgcttatatttgcatatgctaaatttcaaaaaatcgaatctataaagtttataagATG

    BR0936 Gene: BR0936     GI: 23501820     BI number: BR0936     GOG: COG0463     Description: glycosyl transferase, group 2 family protei            ta           g  t           c  a           g  t           a  a            ta            at            gc           a  g            cg            at            gc           |  t           |  t           |  t CT       c  t T  G      t  t CG       t  a TG       t  c CG       t  a TG       c  t GC        At A  A       Cg G  C       Cg        aa C  C       At       t  t T  A      |  a      a  g T  c      |  t       ta Gt       |  c       cg At        Cg        ta G  t       Gt        cg G  t       Gc        cg Gc       |  a      a  c Cg        Gc        cg Ta        Gc        tg Gc        Gt        gc                         tttttaatcccgctctcgatatcgttttccgatattgtcgtaatacgcagcttataaattatcactcacttttacatttaccgcttatatttgcatatgctaaatttcaaaaaatcgaatctataaagtttataagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0463 Glycosyltransferases involved in cell wall biogenesis ... can be seen here     ..................................................................................................................