                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:89 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-12.40 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-12.00 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G=-17.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACCTTGCCACGATGGGAAGCTGCATGATGCGGGTCAAGCTGAAAGGAGTTTAGcaaATG
ATGAAGTTTTCCATCCCCAAGATGAAATGCGGCGGCTGCGCGGAAGCGGTGACTGCGG
CCTTGCGCAAGCTTGATGCCGAAGCGCCGGTTGTCGTTGATCTTGCAAACAAGGAAGT
CGCCTACGGCGGTACGGTTGCGCCGGAAGCGGTTCTTTCCGCATTGGCGGCAGCGGGC
TATCCCGCGACGAGCGCGCAATAAtgtgattttggacctgcttgtaaaccggtccggcaaattgtagGTG

    BR0943 --- BR0944 Gene: BR0943     GI: 23501827     BI number: BR0943     GOG: -------     Description: hypothetical protein Gene: BR0944     GI: 23501828     BI number: BR0944     GOG: COG2518     Description: protein-L-isoaspartate O-methyltransferase, putativ            AA           C  A CA        GC G  A       TA CG        TA GC        CG |  T       TG         G |  T      A  A      C  G T  G      G  |      A  T T  A       TA       T  T C  T       TG       G  G CG       G  T       GC GC       C  C       CG GC        TG        GC CG        GC        GC G  A      T  C       CG TA       T  T      A  G CG       G  A      T  A A  |       GC       C  A GC        CG        CG TG        CG        GC GC        GC        CG GC        CG        TG                         TTCTTTCCGCATTGGCGGCAGCGGGCTATCCCGCGACGAGCGCGCAATAAtgtgattttggacctgcttgtaaaccggtccggcaaattgtagGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG2518 Protein-L-isoaspartate carboxylmethyltransferase ... can be seen here     ..................................................................................................................