                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:136 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G=-11.20 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -5.30 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G= -9.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATTCGTCTCGCCTGTAACGCACTTTATCGTCATTTTTTCACACATAACCGCAAGAAAG
TCGCATGAttgtctttccatatcgagcaaagcagaataatctgcgcatagtttcaggatgcagaattgcgacatgaggattacagcggcttttc
gggccgcttttttactgtttggttactatgaaatgtgtggcgttcagtatgagcgttatggttgcaagtgttgctgaaaaactacagacatttcactcgg
atgatataattaagagatcaatgaatattggaatgtttggagggaaccGTG

    BR0971 Gene: BR0971     GI: 23501854     BI number: BR0971     GOG: COG3637     Description: outer membrane protein, putativ ta a  a at gc at cg gc |  g |  c a  a       aa a  t      g  t a  a      a  t cg        cg gt        gc at        tg gt       a  a c  c      g  c t  a      g  a a  |       at t  |       cg a  |       ta cg       |  g        t cg        tg       t  c ta        ta       t  g t  t       gt        tg t  |       at        cg c  |       ta        gc tg       |  c       gc gc       a  a       cg ta        cg        gc tg        gc        at                         tttttactgtttggttactatgaaatgtgtggcgttcagtatgagcgttatggttgcaagtgttgctgaaaaactacagacatttcactcggatgatataattaagagatcaatgaatattggaatgtttggagggaaccGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG3637 Opacity protein and related surface antigens ... can be seen here     ..................................................................................................................