                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:2 nt.     Distance to run of Ts=3 nt.   Size=34 nt.     Delta G=-15.60 kcal/mol
Antiterminator: Size=23 nt.     Delta G= -6.32 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCATTTGCCAACCCGGCCAAGGGTGCGGACGGTCGAATAGAACTGCATGGCGTCCTCC
AGCGTTTCTATATCATCCTCATCCAGCTTGGACAGAAATTCCTTTGTCCTCTCCGGTA
GCTCACCCATGCGATTGACGGTTCGAGCTTCATTATCCATTGGCGTCACttccagcaccccgcc
gctttcccgaatgcattatgagaagcgataccctgacccgccggtgtatcgtttcctgagagataaacagccgtcgccggtttaaggctgatcggcttcc
acccggcgcagttctttgcaTTG

    BR0985 Gene: BR0985     GI: 23501866     BI number: BR0985     GOG: -------     Description: hypothetical protei            at           g  c            tg            cg            gc   g        gt c  g       at c  t      a  c g  t      t  c c  t      t  a t  a      t  c g  a       gc cg        gc cg        cg gc        cg at        gc cg        cg             cagttctttgcaTTG     ..................................................................................................................