                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:15 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-10.60 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -7.50 kcal/mol
Anti-antiterminator:   Size=24 nt.     Delta G= -8.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCGTCTCTATACGCTGAAAGGTCAGCAGACCTTTGACGATATCAAGCGCAAGTATCA
GACCGATGGTGAATTCCGCCGCGCCGTAGATCGTTACATGGACGATTTCCAACGTCTT
CTCGAAGACGTTGCCCGCAATGACCGCGATAATATGGTGACGCAGACTTACCTGACAT
CCGACACAGGCAAGGTTTACACCATGCTCGCCCATGCAAGCGGACGCCTTCGGTAGag
cggctccagttaaaattgagcaatgaaaaaagcggccttccagccgctttttttgattacaggccactTTG

    BR1023 Gene: BR1023     GI: 23501903     BI number: BR1023     GOG: -------     Description: hypothetical protei            aa           t  a            ta            gt            at           c  |            cg            ta            cg            gc           |  a           |  a           |  t           |  g           |  a GT       |  a G  A      |  a CG       |  a Ta       |  a       tc Tg       g  a      t  c |  c       cg       c  a Cg        gc        cg Cg       a  g       gc Gc       G  |       gc C  |      A  |       cg At        Tg        gc Gc        Gc        at Gc        Gc        at                         tttttgattacaggccactTTG     ..................................................................................................................