                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:117 nt.     Distance to run of Ts=2 nt.   Size=29 nt.     Delta G=-11.30 kcal/mol
Antiterminator: Size=23 nt.     Delta G= -3.10 kcal/mol
Anti-antiterminator:   Size=59 nt.     Delta G= -9.26 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGACGTCGGCAATCTTATGCTCACGGGACATAATCCGAGCATTGAAGATCTGGCGCTT
GCGCTTTGTTCGGATGGCGAGCCAGAGAGCATACACCGCTTGAATGCCGGTTTTCCGA
CCGCAGCACTTGCGACGATTTCCTTTGAAGGCGCCTTGACGAATATCGAACCGGGGCG
TGGTTTTCTGGAGAGTTTTCTGCTGTCACATTGAaaatgttgcggtgctgaaacggtttccttgccaaattcaac
ccagtgtccctatctattacgtgacaccgcagcaatttcggcgagggcataTTG

    BR1034 --- BR1033 Gene: BR1034     GI: 23501913     BI number: BR1034     GOG: COG3106     Description: conserved hypothetical protein Gene: BR1033     GI: 23501912     BI number: BR1033     GOG: COG3768     Description: conserved hypothetical protei TC T  C TG TA GC GC C  | CG GC TA |  G A  C A  A G  C T  T T  T                  T CG                 A  A GC                 A  T CG        TT        GC |  A      C  T       CG C  C       CG       |  A A  G       TA       |  A C  A       TA       A  C A  T       TG        GC T  T      A  G       TG A  T      G  |       TG C  C      C  |       CG GC       A  |       CG AT        GC        GC GT        CG        CG AT        GC        GT                         GGTTTTCTGGAGAGTTTTCTGCTGTCACATTGAaaatgttgcggtgctgaaacggtttccttgccaaattcaacccagtgtccctatctattacgtgacaccgcagcaatttcggcgagggcataTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG3106 Predicted ATPase ... can be seen here [S] COG3768 Predicted membrane protein ... can be seen here     ..................................................................................................................