                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:60 nt.     Distance to run of Ts=2 nt.   Size=22 nt.     Delta G= -7.70 kcal/mol
Antiterminator: Size=68 nt.     Delta G=-20.66 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G=-14.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

atgcggccaggaaaggtctgcatttcgagccaaattgattttcgggctgtaaaccaccccgtcctttcacgatatgcttgcaaaaaccgcctttttgcgg
ttatcagcatcacccggcgctggctgtgccgggtggaaagcctttccactatcttgctgccgcttgtcgccggcgcagacgatggaaagcggcatatccg
acagttggcgcgaatgacggcatgtcatcgcagatttttggttttttgcaggtccgcagggcgcaaccccacgccacggatcgatccatggagcgtttcg
ATG

    BR1046 Gene: BR1046     GI: 23501924     BI number: BR1046     GOG: COG0503     Description: phosphoribosyltransferase family protei            ag           a  c           a  g           g  g            gc            ta            at           |  a           g  t           c  c           a  c   g       g  g t  t      a  a t  c      c  c cg       g  a gc        cg |  c       gt cg        gt cg        cg gc        cg t  |       gc cg        cg gc       t  | t  |       gc         c ta        tg       g  a cg        ta       g  t ta       c  a       cg a  c       gt        at t  g       cg        gc c  a      c  a       ta at        gc       a  | cg        tg        at cg        cg        gc ta        gc        cg ta        ta        gc                         agatttttggttttttgcaggtccgcagggcgcaaccccacgccacggatcgatccatggagcgtttcgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG0503 Adenine/guanine phosphoribosyltransferases and related PRPP-binding proteins ... can be seen here     ..................................................................................................................