                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:113 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-20.10 kcal/mol
Antiterminator: Size=55 nt.     Delta G=-15.54 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-17.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCGCCCCGCACAGAAGGCGGGCGAGCAGCATCGCGCCGGGGCACATGCCAGCGCCGGT
GAGGCCGCGCCGAAGCCGAAGCGTCCCTTCCGCCGCAAGCGCCGCAGCAATGGCGGCC
AGCGCGCCGCCTGAtccaaaagcaaaacacatttcgcgaaaagccgccttatagggcggcttttctgttttatgcctctacaggagtttc
agtttgccctttggcgtggaaaattattccatacttgcttgaagggcagggcgcttccccataacttcgccttcaaacagaaaggacggaagccATG

    BR1051 --- BR1052 --- BR1053 --- BR1054 Gene: BR1053     GI: 23501931     BI number: BR1053     GOG: COG0031     Description: cysteine synthase Gene: BR1054     GI: 23501932     BI number: BR1054     GOG: COG2872     Description: conserved hypothetical protein Gene: BR1055     GI: 23501933     BI number: BR1055     GOG: COG2897     Description: rhodanese family protein Gene: BR1056     GI: 23501934     BI number: BR1056     GOG: COG0454     Description: acetyltransferase, GNAT famil            aa CG       a  g C  C      a  c G  A      c  a CG       c  a GC       t  a A  A      A  a A  A       Gc C  |       Ta GT       C  c CG       C  a CG       G  t GC       C  t CG       C  t CG        Gc        at T  C       Cg       t  a T  C       Gc        tg C  A       Cg        cg C  |      |  a       cg C  |      G  a       gc TG       A  a       cg GC       C  a       cg CG        Cg        gc GC        Gc        at A  G       Gc        at A  C       Cg        at GC        Gc        at CG        Gc        gc                         tgttttatgcctctacaggagtttcagtttgccctttggcgtggaaaattattccatacttgcttgaagggcagggcgcttccccataacttcgccttcaaacagaaaggacggaagccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0031 Cysteine synthase ... can be seen here [R] COG2872 Predicted metal-dependent hydrolases related to alanyl-tRNA synthetase HxxxH domain ... can be seen here [P] COG2897 Rhodanese-related sulfurtransferase ... can be seen here [KR] COG0454 Histone acetyltransferase HPA2 and related acetyltransferases ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_suis_1330_I                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:120 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-12.90 kcal/mol Antiterminator: Size=55 nt.     Delta G=-15.54 kcal/mol Anti-antiterminator:   Size=37 nt.     Delta G=-14.40 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CCGCCCCGCACAGAAGGCGGGCGAGCAGCATCGCGCCGGGGCACATGCCAGCGCCGGT GAGGCCGCGCCGAAGCCGAAGCGTCCCTTCCGCCGCAAGCGCCGCAGCAATGGCGGCC AGCGCGCCGCCTGAtccaaaagcaaaacacatttcgcgaaaagccgccttatagggcggcttttctgttttatgcctctacaggagtttc agtttgccctttggcgtggaaaattattccatacttgcttgaagggcagggcgcttccccataacttcgccttcaaacagaaaggacggaagccATG     BR1051 --- BR1052 --- BR1053 --- BR1054 Gene: BR1053     GI: 23501931     BI number: BR1053     GOG: COG0031     Description: cysteine synthase Gene: BR1054     GI: 23501932     BI number: BR1054     GOG: COG2872     Description: conserved hypothetical protein Gene: BR1055     GI: 23501933     BI number: BR1055     GOG: COG2897     Description: rhodanese family protein Gene: BR1056     GI: 23501934     BI number: BR1056     GOG: COG0454     Description: acetyltransferase, GNAT famil            ca           a  t           c  t           a  t           a  c           a  g           a  c            cg   A        ga C  A      a  a G  T      a  a A  G      a  a CG       a  g GC       c  c CG        cc CG        tg GC        Ac |  C       Gc |  A      |  t CG       T  t       at GC       C  a      t  a A  G      C  t       tg A  C       Ga        cg CG        C        cg GC        C        gc C  C       G        cg CG        C        cg GC        G        gc                         ttttctgttttatgcctctacaggagtttcagtttgccctttggcgtggaaaattattccatacttgcttgaagggcagggcgcttccccataacttcgccttcaaacagaaaggacggaagccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0031 Cysteine synthase ... can be seen here [R] COG2872 Predicted metal-dependent hydrolases related to alanyl-tRNA synthetase HxxxH domain ... can be seen here [P] COG2897 Rhodanese-related sulfurtransferase ... can be seen here [KR] COG0454 Histone acetyltransferase HPA2 and related acetyltransferases ... can be seen here     ..................................................................................................................