                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:22 nt.     Distance to run of Ts=3 nt.   Size=32 nt.     Delta G=-10.90 kcal/mol
Antiterminator: Size=38 nt.     Delta G=-12.80 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G=-13.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tgtggcagtcactacagcccagctgtttagtcctgtcattttatttcaagcatgatcctgatcgccgtcgcttcattccggccggattatgccctaaatt
atgaatagctaaaaaaatatgcggaagtgttggaaaacaccttgtcggcacgtggccgcgacataacttacctgatcccataatattgcttgtttcgttt
tcccgccgggcaaacggaaccgccaaatgaaattgtggttcatgccgagattgtacatcggcgaccaaagatttttcgatgcactgccccggaggatact
GTG

    BR1060 --- BR1059 Gene: BR1060     GI: 23501938     BI number: BR1060     GOG: COG1566     Description: HlyD family secretion protein Gene: BR1059     GI: 23501937     BI number: BR1059     GOG: COG0477     Description: drug resistance transporter, EmrB/QacA famil             g           t  a   c       a  a g  c      a  a        g cg       a  t      t  t cg       c  t      t  a cg        cg       a  c t  c       gt       g  a ta        cg        at ta        cg        gc ta        at        cg gc        at        cg cg        gc        gc tg       g  a      t  | ta       c  |      a  | ta       a  |      c  | gc       a  |       tg t  c       at        ta t  |       cg        gc cg        gc        gc gc        gc        ta                         aagatttttcgatgcactgccccggaggatactGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [V] COG1566 Multidrug resistance efflux pump ... can be seen here [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here     ..................................................................................................................