                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:25 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-21.40 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -7.70 kcal/mol
Anti-antiterminator:   Size=34 nt.     Delta G=-14.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGCCCGAAATGATTTCTATCGTCAAGCGCAACAATTGCGGCAAGGCTCTGGATATTG
CCCGCCAGGCCCGTGATATGCATGGCGGCAACGGTATCCAGATTGAATATCACGTCAT
GCGCCACGCGCAGAATCTGGAAACCGTCAACACCTATGAGGGCACGCACGACGTTCAC
GCGCTGATTCTCGGCCGTGCCCAGACCGGCATTCAGGCGTTCTTCTGAtcgtcggttccaagcc
tgcttttggcccgctcgcaatttgcgggcgggctttcttatattcatttgggattgctgaacATG

    BR1084 Gene: BR1084     GI: 23501962     BI number: BR1084     GOG: COG1804     Description: CAIB/BAIF family protei             c           c  a           t  a            tg            gc            gc           c  t TT        tg G  C       gc C  T      c  t GT       t  t GC        At         t AT        Gt       a  t CG        Tg       a  t TA        Cg        cg T  t      |  c       gc A  c      T  c       cg Cg       T  c       tg Gt       C  g       cg Gc       T  c       gc Cg       T  t       cg Cg        Gc        cg At        Cg        cg Gt        Gc        gc                         tttcttatattcatttgggattgctgaacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1804 Predicted acyl-CoA transferases/carnitine dehydratase ... can be seen here     ..................................................................................................................