                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:24 nt.     Distance to run of Ts=1 nt.   Size=24 nt.     Delta G=-16.80 kcal/mol
Antiterminator: Size=67 nt.     Delta G=-16.02 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCGCTTGGCGTGGTGCCGCTGATAATCGCCACCGGCGCAGGCGCTGCCGCCCGTTAC
TCGATGGGGCTGGTGATCTTCACAGGCATCACGATCGGCACCATCTTTACGCTGTTCG
TGGTGCCGATGTTTTATACTTTCATTGCAAAGAAGGATGTTGAGGGCGGGTATTTTAC
GCCCTCGGAAGAAGGCAGTGAATCTGCGCCAGTGCAACATCACTGAaacttgcgttgaaccacgga
caaagggcggcctagaaataagccgccccttttatttgtcgaatgaccatatgagccagcATG

    BR1087 Gene: BR1087     GI: 23501965     BI number: BR1087     GOG: COG2141     Description: bacterial luciferase family protei AC A  A C  T GC TA GC AT CG |  A |  a |  a |  c |  t |  t Cg Gc Cg Gt T  t Cg Ta A  a A  c Gc Ta Gc |  g |  g |  a |  c |  a       aa |  a      g  a |  a       at |  g       ta |  g      c  a |  g       cg |  c       gc A  g       gc Cg        cg Gc        gc Gc        gc At        gc             cttttatttgtcgaatgaccatatgagccagcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG2141 Coenzyme F420-dependent N5,N10-methylene tetrahydromethanopterin reductase and related flavin-dependent oxidoreductases ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_suis_1330_I                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:168 nt.     Distance to run of Ts=1 nt.   Size=35 nt.     Delta G=-16.52 kcal/mol Antiterminator: Size=43 nt.     Delta G=-15.70 kcal/mol Anti-antiterminator:   Size=26 nt.     Delta G= -8.90 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GGCGCTTGGCGTGGTGCCGCTGATAATCGCCACCGGCGCAGGCGCTGCCGCCCGTTAC TCGATGGGGCTGGTGATCTTCACAGGCATCACGATCGGCACCATCTTTACGCTGTTCG TGGTGCCGATGTTTTATACTTTCATTGCAAAGAAGGATGTTGAGGGCGGGTATTTTAC GCCCTCGGAAGAAGGCAGTGAATCTGCGCCAGTGCAACATCACTGAaacttgcgttgaaccacgga caaagggcggcctagaaataagccgccccttttatttgtcgaatgaccatatgagccagcATG     BR1087 Gene: BR1087     GI: 23501965     BI number: BR1087     GOG: COG2141     Description: bacterial luciferase family protei             A           C  C           T  A            TG            CG           |  C            TA         G            AT       C  C            GC       A  T            TA       T  G   T        GC       T  T C  C      |  G      T  T A  G      |  A      C  C T  A      |  T       TG T  T       GC        AT G  G       TG        CG CG        CG        CG CG        GC        AT CG       G  A       CG GC        GC        GC |  T       GC        GC CG        TA        CG CG        AT        TA GT        GC        AT                         GTTTTATACTTTCATTGCAAAGAAGGATGTTGAGGGCGGGTATTTTACGCCCTCGGAAGAAGGCAGTGAATCTGCGCCAGTGCAACATCACTGAaacttgcgttgaaccacggacaaagggcggcctagaaataagccgccccttttatttgtcgaatgaccatatgagccagcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG2141 Coenzyme F420-dependent N5,N10-methylene tetrahydromethanopterin reductase and related flavin-dependent oxidoreductases ... can be seen here     ..................................................................................................................