                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:170 nt.     Distance to run of Ts=2 nt.   Size=25 nt.     Delta G= -7.40 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-14.10 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-18.11 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGCTTTGGTGGGGAAGGAATAGAGCAGTCCACCTTTGGAAAGGCCCGCACGAGCAGC
AACAGCATCGAGTGAAATATGGGCCGGGCCGACTTCCTGCGCCAGCTCGGTTGCTGCA
CGTAAAATTTTTTCGCGTGAATTCTCCCTCTTTGTTGGTAACAAtttacttgatctcctgaccgttc
atatgctgacattaccgtccagacggtacagttgcccgcctctctcattcaagtaaattaagcgcgacctttgcgtaaaaggggatgcgcttcaaagcca
ccttggagttcatccgaATG

    BR1089 --- BR1088 Gene: BR1089     GI: 23501967     BI number: BR1089     GOG: COG0845     Description: conserved hypothetical protein Gene: BR1088     GI: 23501966     BI number: BR1088     GOG: COG0841     Description: AcrB/AcrD/AcrF multidrug efflux protei   A C  A G  C A  A CG GC |  A        A AT       G  C GC       C  T CG       C  T A  A       GC CG        GC GT        GT |  G       CG |  A      |  C |  A       CG |  A       GC |  T       GC |  A      G  A |  T      T  |       GG CG       A  |      C  T CG       T  |      T  T CG       A  |       CG GC       A  |       GC GC       A  |       AT A  G      G  |       CG A  G       TG       |  C A  G       GC       C  A GC        AT        GC GC        GC        CG TG        CG        GT TA        TG        TA                         AAATTTTTTCGCGTGAATTCTCCCTCTTTGTTGGTAACAAtttacttgatctcctgaccgttcatatgctgacattaccgtccagacggtacagttgcccgcctctctcattcaagtaaattaagcgcgacctttgcgtaaaaggggatgcgcttcaaagccaccttggagttcatccgaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0845 Membrane-fusion protein ... can be seen here [V] COG0841 Cation/multidrug efflux pump ... can be seen here     ..................................................................................................................