                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:46 nt.    Distance to gene:70 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-11.00 kcal/mol
Antiterminator:    Distance from promoter:13 nt. Size=49 nt.     Delta G= -7.60 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G=-25.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tggaca-caggat. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tggacatcaaagaattcgccttccaggattgagcgcatattgagccagtcctgtaaggtgaacattctagtttctggttatggacgcagttgcgcctgac
ctttcttttggaaagcgccccttgtctggacgaagacgtgtggaaaaggtgcgtgcaagacccggagtaagttttcgATG

    BR1102 Gene: BR1102     GI: 23501980     BI number: BR1102     GOG: COG0629     Description: single-stranded DNA-binding protein famil   a t  t at cg g  a       tc cg       t  t gc       a  a a  |       cg gc        at ta        at tg        gt at       t  | gc        gc gc        gt at       |  g cg       a  g c  t      a  t       gt ta       t  t      a  t ta       g  a       cg cg       t  t       gc cg        cg        cg gt        cg       a  | cg        ta        gc ta        gc        gc |  a      |  g      t  | |  c      a  c       at ta       c  a       tg at        cg        ta at        gt        gc gc        at        gc                         tttcttttggaaagcgccccttgtctggacgaagacgtgtggaaaaggtgcgtgcaagacccggagtaagttttcgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0629 Single-stranded DNA-binding protein ... can be seen here     ..................................................................................................................