Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:167 nt.     Distance to run of Ts=2 nt.   Size=22 nt.     Delta G= -9.10 kcal/mol
Antiterminator: Size=42 nt.     Delta G=-11.10 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G=-26.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tgcacgccgcgaaggccggttttccctctggacagccataagaaaagccctgccgctcactgtatctttggcgcgcagggcttggggttgagcaaagctc
tcatgtcgacagtgcttcgtcgacaaattctttcggaaatcaatggcgcacagccatcttccttccgcgtgtgaggtaaattttcggcaatcgatatctt
gatcaacgatgcatcattccttgcgaaaagatgccgctacaatcaaatccgattgtgctttcgttcttacgaaagcgacataacctagtcaggtggactc
ATG

    BR1103


Gene: BR1103     GI: 23501981     BI number: BR1103     GOG: -------     Description: hypothetical protei


 ta
g  t
t  c
c  t
a  t
c  t
 tg
 cg
 gc
 cg         g
|  c      t  a
 cg        tg
 gc        gc
 ta       g  a
 cg       g  |
 cg       g  |
 cg        ta
 gc        ta
 at        cg
 at        gc
a  g       gt
a  g       gc        gc
g  |       at       t  t
a  |      c  c      g  t
a  |      g  a      a  c
t  |      c  |       cg
a  |       gt        at
 cg        cg        gc
 cg        gt        cg
 gt        gc        ta
 at        tg        gc
 cg        ta        ta
                        aattctttcggaaatcaatggcgcacagccatcttccttccgcgtgtgaggtaaattttcggcaatcgatatcttgatcaacgatgcatcattccttgcgaaaagatgccgctacaatcaaatccgattgtgctttcgttcttacgaaagcgacataacctagtcaggtggactcATG


    ..................................................................................................................