Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:123 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G=-15.50 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -9.80 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-17.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CACGAAGATCCCGATAATGCTCCGTCCGACGGCCCCAACATGGTGCCGATCGACAAGA
TGCCGGCGCTTCTGGAAAAGCTGATGGCATTCGATCGCATTGCCAAGGCGCTGTAAgc
ctggaaagtgcatgagactggcggggattttccccgccttttgtttgattacatctttattttcaccgcatttgtcacacgccggatgtttccatttggc
tgtaaaatgctctaaggatgtgcccatatcggatttgttaatgcctgccggcggcaggcaatctataggaaaggactggctcctATG

    BR1131


Gene: eno     GI: 23502010     BI number: BR1132     GOG: COG0148     Description: enolas


 AT
C  T
G  C       cc
G  G      g  t
 TA       A  g
 AT       A  g
 GC       T  a
T  |      G  a
 CG        Ta
 GC        Cg
A  A       Gt
A  T       Cg
A  T       Gc
A  G      |  a
 GC       |  t
 GC       |  g
 TA       |  a        t
C  |      |  g      t  t
 TA       G  a      a  t
 TG       A  c       gc
 CG        At        gc
 GC        Cg        gc
 CG        Cg        gc
 GC        Gc        cg
 GT        Tg        gc
 CG        Tg        gc
                        ttttgtttgattacatctttattttcaccgcatttgtcacacgccggatgtttccatttggctgtaaaatgctctaaggatgtgcccatatcggatttgttaatgcctgccggcggcaggcaatctataggaaaggactggctcctATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[G] COG0148 Enolase ... can be seen here

    ..................................................................................................................


                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:140 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G=-15.50 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -9.80 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-17.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CACGAAGATCCCGATAATGCTCCGTCCGACGGCCCCAACATGGTGCCGATCGACAAGA
TGCCGGCGCTTCTGGAAAAGCTGATGGCATTCGATCGCATTGCCAAGGCGCTGTAAgc
ctggaaagtgcatgagactggcggggattttccccgccttttgtttgattacatctttattttcaccgcatttgtcacacgccggatgtttccatttggc
tgtaaaatgctctaaggatgtgcccatatcggatttgttaatgcctgccggcggcaggcaatctataggaaaggactggctcctATG

    BR1131


Gene: eno     GI: 23502010     BI number: BR1132     GOG: COG0148     Description: enolas


 AT
C  T
G  C       gc
G  G      A  c
 TA       A  t
 AT       T  g
 GC       G  g
T  |      T  a
 CG        Ca
 GC        Ga
A  A       Cg
A  T       Gt
A  T       Gg
A  G      |  c
 GC       |  a
 GC       |  t
 TA       |  g        t
C  |      |  a      t  t
 TA       A  g      a  t
 TG       A  a       gc
 CG        Cc        gc
 GC        Ct        gc
 CG        Gg        gc
 GC        Tg        cg
 GT        Tc        gc
 CG        Ag        gc
                        ttttgtttgattacatctttattttcaccgcatttgtcacacgccggatgtttccatttggctgtaaaatgctctaaggatgtgcccatatcggatttgttaatgcctgccggcggcaggcaatctataggaaaggactggctcctATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[G] COG0148 Enolase ... can be seen here

    ..................................................................................................................