                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:123 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G=-15.50 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -9.80 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-17.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CACGAAGATCCCGATAATGCTCCGTCCGACGGCCCCAACATGGTGCCGATCGACAAGA
TGCCGGCGCTTCTGGAAAAGCTGATGGCATTCGATCGCATTGCCAAGGCGCTGTAAgc
ctggaaagtgcatgagactggcggggattttccccgccttttgtttgattacatctttattttcaccgcatttgtcacacgccggatgtttccatttggc
tgtaaaatgctctaaggatgtgcccatatcggatttgttaatgcctgccggcggcaggcaatctataggaaaggactggctcctATG

    BR1131 Gene: eno     GI: 23502010     BI number: BR1132     GOG: COG0148     Description: enolas AT C  T G  C       cc G  G      g  t TA       A  g AT       A  g GC       T  a T  |      G  a CG        Ta GC        Cg A  A       Gt A  T       Cg A  T       Gc A  G      |  a GC       |  t GC       |  g TA       |  a        t C  |      |  g      t  t TA       G  a      a  t TG       A  c       gc CG        At        gc GC        Cg        gc CG        Cg        gc GC        Gc        cg GT        Tg        gc CG        Tg        gc                         ttttgtttgattacatctttattttcaccgcatttgtcacacgccggatgtttccatttggctgtaaaatgctctaaggatgtgcccatatcggatttgttaatgcctgccggcggcaggcaatctataggaaaggactggctcctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0148 Enolase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_suis_1330_I                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:140 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G=-15.50 kcal/mol Antiterminator: Size=43 nt.     Delta G= -9.80 kcal/mol Anti-antiterminator:   Size=50 nt.     Delta G=-17.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CACGAAGATCCCGATAATGCTCCGTCCGACGGCCCCAACATGGTGCCGATCGACAAGA TGCCGGCGCTTCTGGAAAAGCTGATGGCATTCGATCGCATTGCCAAGGCGCTGTAAgc ctggaaagtgcatgagactggcggggattttccccgccttttgtttgattacatctttattttcaccgcatttgtcacacgccggatgtttccatttggc tgtaaaatgctctaaggatgtgcccatatcggatttgttaatgcctgccggcggcaggcaatctataggaaaggactggctcctATG     BR1131 Gene: eno     GI: 23502010     BI number: BR1132     GOG: COG0148     Description: enolas AT C  T G  C       gc G  G      A  c TA       A  t AT       T  g GC       G  g T  |      T  a CG        Ca GC        Ga A  A       Cg A  T       Gt A  T       Gg A  G      |  c GC       |  a GC       |  t TA       |  g        t C  |      |  a      t  t TA       A  g      a  t TG       A  a       gc CG        Cc        gc GC        Ct        gc CG        Gg        gc GC        Tg        cg GT        Tc        gc CG        Ag        gc                         ttttgtttgattacatctttattttcaccgcatttgtcacacgccggatgtttccatttggctgtaaaatgctctaaggatgtgcccatatcggatttgttaatgcctgccggcggcaggcaatctataggaaaggactggctcctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0148 Enolase ... can be seen here     ..................................................................................................................