                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:154 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-20.30 kcal/mol
Antiterminator: Size=24 nt.     Delta G= -9.60 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G= -7.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCCAGCCCGATGCCGGACAGCCGCAGGCTCCGGCAGCCCCGGCAAATCCGGTTCCCAG
CTCGCAATAAagatctgggaaagagccgggaaagagcacggcaaattgattatcgggaaaccggccatcatggccggttttctttttgttaag
catagaacggcaaagtgttgcatgagggccataggccgtagcgattcgcattgcttgagtgctggagcgaattgagatgctcccaagtttacagtatgca
aagcgtaagcctgaacgcaggggttgcggcaggtattttccgctcgtgcTTG

    BR1135 Gene: BR1136     GI: 23502014     BI number: BR1136     GOG: COG1376     Description: conserved hypothetical protei ag a  a a  g g  c g  a gc cg cg gc |  a                  c a  a                t  a g  a                a  t at        aa        cg at       g  a       cg |  g       gc        gc |  a       gc        gc |  t       cg        cg a  t       tg        cg g  a      a  c       at gt       t  c       at gc        ta        at tg        at        gt cg        gc        gc tg        ta        gt                         ttttgttaagcatagaacggcaaagtgttgcatgagggccataggccgtagcgattcgcattgcttgagtgctggagcgaattgagatgctcccaagtttacagtatgcaaagcgtaagcctgaacgcaggggttgcggcaggtattttccgctcgtgcTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1376 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................