                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:19 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-23.00 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-12.10 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G=-12.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGCTTGCGTCCCGGCGATATTATCCGCAGCATCAACGGCAATCAGATTCGCACCGTT
GACGATATGACCGCCGTGCTTGAGGCCGGACGTGGTCTGGCATGGCGGCTGGAAATTG
AACGCAACGGCGCTTTGCTGCGCCAGTTCGTGCGCTAGgcccattaaacggagacgctggaacgcgttctaa
cgcaagttacgcccggcaggattatgctccggcaccggcggacagacgttgcatgccgcttcaggggggattatgcctgaagcggcattttgtttatgat
cgagcgattggaATG

    BR1206 Gene: BR1206     GI: 23502083     BI number: BR1206     GOG: COG2256     Description: ATPase, AAA famil            ca           a  g           g  a            gc at        cg t  g       gt t  c       gt        at at        cg       g  t gc       |  c      g  a gc       c  a      g  t a  g       at       g  g cg        cg        gc gc        gc        gc |  a       gc        at g  c      |  g       cg c  c      |  c       ta cg       |  t       ta cg       |  t       cg gc       |  c       gc cg       |  a       cg a  |       cg        cg tg        cg        gc ta        tg        ta gc        cg        at                         tttgtttatgatcgagcgattggaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG2256 ATPase related to the helicase subunit of the Holliday junction resolvase ... can be seen here     ..................................................................................................................