                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:83 nt.    Distance to gene:66 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-19.60 kcal/mol
Antiterminator:    Distance from promoter:50 nt. Size=43 nt.     Delta G= -9.90 kcal/mol
Anti-antiterminator:    Distance from promoter:22 nt.    Size=49 nt.     Delta G=-11.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaaa-ttagtt. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaaaagcccgcaaatacaggcttagttgagggcatcagaagaagccattgacttgTCAGGCGTTTTTCTGATCTCCAGAT
TTCATGTTGCGGACAGTTCCTGCTCGCATCAGGGCCGGTCGGGAAACTCCGCCGGCCT
TTATTTTTAACATattctaccctatcaacatgtgtgatgcgcagggaaggcgaaccgtaaggggcgcctgccgATG

    BR1256 Gene: BR1256     GI: 23502132     BI number: BR1256     GOG: COG0705     Description: rhomboid family protei   C T  T A  C GC TA         T CG       T  C TA        GC |  T       AT T  T       CG T  T      A  C T  C      G  T TA        GC GT        CG        AA CG        GC       A  C GT        TA        GT GT       T  T       GC |  G       GC        GC |  C       TA        CG A  G      A  G      T  | CG        CG        GC TA        TG        GC gC       |  C       CG t  |      |  C       CG tA        TG        GC cG        TG        GC aT        AT        GT gT        GC        AT                         TATTTTTAACATattctaccctatcaacatgtgtgatgcgcagggaaggcgaaccgtaaggggcgcctgccgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0705 Uncharacterized membrane protein (homolog of Drosophila rhomboid) ... can be seen here     ..................................................................................................................