                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:168 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -8.80 kcal/mol
Antiterminator: Size=64 nt.     Delta G=-24.70 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-16.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AATGGCGCTCTATAAGGCGGGCGAAACTTACCGGCTTGAGCCGCAATGGGCCGCAGAG
GAAGGGTTTACGGAAATCAGGCGCGAGCTTGAGCTGAATGAATCCGTGCCGGAGGTGA
AGGGAAGCCTCCTTTTTCGTGAATCCTTTCTCAGGGAACCGAAGCTGCGGAAAATAAC
AGATTATCTGGCGAGAAACTGGGGCGGCTGCGCCCGGCACAAGGACGCGCCCGCACAG
AAGAAAGCTAAAAATCCTTTTTAAatcaatggcttatgttggatgtcaacttaaatcgcaatatttgaTTG

    BR1353 Gene: BR1353     GI: 23502225     BI number: BR1353     GOG: -------     Description: hypothetical protei            CG           G  A            CG            GC            GT            AT AG        CG G  G       TA A  A      A  G C  A      A  | G  G      A  | CG        GC CG        GT GT        CG GT       |  A GT       |  A TA        AT A  |       TG A  |       TA C  |       TA GC        GT CG        GC CG        GC |  A      |  G |  A      A  T G  A      A  G       GG AT        GC       A  G GC        GC       A  A TA       |  G      G  A TG       A  G       TG CG       G  A       GC GC       A  G       GC |  G       CG        AT GC        GT        GC CG        CG        GC                         TTTTTCGTGAATCCTTTCTCAGGGAACCGAAGCTGCGGAAAATAACAGATTATCTGGCGAGAAACTGGGGCGGCTGCGCCCGGCACAAGGACGCGCCCGCACAGAAGAAAGCTAAAAATCCTTTTTAAatcaatggcttatgttggatgtcaacttaaatcgcaatatttgaTTG     ..................................................................................................................