                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:144 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-22.20 kcal/mol
Antiterminator: Size=80 nt.     Delta G=-15.41 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-21.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCTGCTTGCACGCACAGCTTCCGATGCCACCGAATATTTCCAGATCCCGACCGGGCGG
GTGGTCGAGATCGGAACACAGGTGAATATCTAAAGCCTTTCCCTTAAAAAAAGGGGTA
GAAAAAAGCGCCTTTCGGAAGCTCCCGAAAGGCGCTTTTTGTCTATGGCGCGACCGGG
CAAACGGCTCGCAAAAAATTTCACGATGAATATGCGAAATTTCTGGAAAACATGCTTG
ACCGCTGGCAAaacagaaattaaaaatcaggaaccgtaccgtacggtacaaggtggaggaaatgatacGTG

    BR1381 --- ilvC --- BR1379 Gene: BR1381     GI: 23502252     BI number: BR1381     GOG: COG1309     Description: transcriptional regulator, TetR family Gene: ilvC     GI: 23502251     BI number: BR1380     GOG: COG0059     Description: ketol-acid reductoisomerase Gene: BR1379     GI: 23502250     BI number: BR1379     GOG: -------     Description: hypothetical protei             A           A  A           A  A            TA            TA            CG            CG            CG            TG           T  |           T  |           C  |           C  |           G  |           A  |           A  |            AT            TA            CG            TA           |  A CG       |  A G  G      A  A G  G      T  A GT       A  A CG       A  G CG        GC AT        TG GC        GC CG        GC C  A       AT CG       C  | TA       A  | AT       C  | GC       A  | A  |      A  |       GC CG       G  |      A  T CG       G  |      A  C TA       C  |       GC TA       T  |       GC T  C      A  |       CG A  A       GT        TA T  C       AT        TA A  A       GC        TA A  |       CG        CG G  |       TG        CG CG       G  A       GC CG       G  A       CG AT        TG        GC CG        GC        AT                         TTTTGTCTATGGCGCGACCGGGCAAACGGCTCGCAAAAAATTTCACGATGAATATGCGAAATTTCTGGAAAACATGCTTGACCGCTGGCAAaacagaaattaaaaatcaggaaccgtaccgtacggtacaaggtggaggaaatgatacGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1309 Transcriptional regulator ... can be seen here [EH] COG0059 Ketol-acid reductoisomerase ... can be seen here     ..................................................................................................................