                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:77 nt.     Distance to run of Ts=2 nt.   Size=31 nt.     Delta G=-12.00 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -6.80 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G= -3.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGGACAAGCTCTAGGGCAGTCTGCCACTGTCATAAGCGTCGGGGGCGCGCCGGGCCG
CATGGGGGAAGCATTGAAGCAGTTTTCCGAAATTCGCATTCCGCGCCGAAATATTCCG
GCTCTTTGCATTCGCGCAGAGTGTTTCCTTCAATCGGCATGAtgcttatgactaaagctaatcagggca
aagatgcggcagggatgtcgcaaagtgcaacttttttcgcccgtccacattattccatcctgaccctcagtctctccggccagtacactttcaggaaatt
gcgaggtgcctgcatATG

    BR1383 Gene: BR1383     GI: 23502254     BI number: BR1383     GOG: COG3158     Description: potassium uptake protei            ag           a  c   G        at T  A       ta A  t      c  a Cg        at        gg Gc        gc       g  a Gt        ta        at C  t      a  |       cg T  a       tg        gt A  |       tg        gc At        cg        cg Cg        gc        gc Ta        ta        ta T  c      |  a      a  a C  t      A  a      g  a C  a      G  g      a  g Ta        Ta       a  | Ta        At        at Tg        Cg        cg Gc        Gc        gc                         aacttttttcgcccgtccacattattccatcctgaccctcagtctctccggccagtacactttcaggaaattgcgaggtgcctgcatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG3158 K+ transporter ... can be seen here     ..................................................................................................................