                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:200 nt.     Distance to run of Ts=1 nt.   Size=20 nt.     Delta G= -7.20 kcal/mol
Antiterminator: Size=39 nt.     Delta G=-17.20 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G=-21.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGAGGGTATGCTTCGCATCGCCGGGATTGCCGCGCTGGCAATCGGTGTCGGTATCGT
CTGGCTTGTCAGGGGATAAggcgcttcttgtccgttatttcttccatgcaaatctaggcggagccgtaaacaggccgtattttgca
gtgatctaaagcatttccagcaagagcgttaaacggttttgcgttggaaaatgcgacaaaacaaatggttagagcggttccagcgattctgttagaacga
gggccgcgctaaacttggacaacgaccgcaagcagacaggaacggagcagagcttcATG

    BR1394 --- BR1393 --- BR1392 Gene: BR1394     GI: 23502265     BI number: BR1394     GOG: COG0265     Description: serine protease Do, putative Gene: BR1393     GI: 23502264     BI number: BR1393     GOG: -------     Description: hypothetical protein Gene: BR1392     GI: 23502263     BI number: BR1392     GOG: COG2081     Description: conserved hypothetical protein TIGR0027   A C  A G  T GC        TT TG       C  G CG        GT GT        GC CG        TA |  T       CG GC        TG CG       G  G CG        CG GT        TA TA        AT        gc |  T       TA       c  t T  C      G  A       gt A  G      G  |       gc GT        Cg        At GC        Tg        At GT        Gc        Tg CG        Tg        At CG        Gc        Gc GC        Gt        Gc                         gttatttcttccatgcaaatctaggcggagccgtaaacaggccgtattttgcagtgatctaaagcatttccagcaagagcgttaaacggttttgcgttggaaaatgcgacaaaacaaatggttagagcggttccagcgattctgttagaacgagggccgcgctaaacttggacaacgaccgcaagcagacaggaacggagcagagcttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0265 Trypsin-like serine proteases, typically periplasmic, contain C-terminal PDZ domain ... can be seen here [R] COG2081 Predicted flavoproteins ... can be seen here     ..................................................................................................................