                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:210 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G= -7.90 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -7.00 kcal/mol
Anti-antiterminator:   Size=41 nt.     Delta G= -8.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cctgacgtcaatcagtttgggatctaatatatATGCTGCGTATCATCGCCCAAGCAGTTCTCTGGCTAAGC
GGTCTTATCGCCGCTTTCTTTGTGGCCAGGGACGAGCCGAACTTCCCTCTCCTTCAAA
TGACGGTGGGGCTTCTGCTGCTTGTGGGAGTTTCGGTCGCGATCTGGTGGTTCACCGA
TCCGGACAGGTCGAAAAAATAAaacagccggagcggactgccttcgacctcacttgcgcaaacgggacgatgcgcgcaatattg
cgcaaatctgtcataacaccgtgaccctcATG

    BR1406 --- BR1407 Gene: BR1406     GI: 23502277     BI number: BR1406     GOG: NOG09853     Description: conserved hypothetical protein Gene: BR1407     GI: 23502278     BI number: BR1407     GOG: COG4321     Description: conserved hypothetical protei   G T  C A  T t  G a  C tG        TC aT       T  T tA        GC aT        AT a  C      |  G t  A       CG c  T       GC t  C       AT        TA a  G      A  A      T  T gC       C  A      C  C gC       C  |       TG gC        CG        GC tA        GC        GC tA        CG        CG tG        TG        GC gC        AT        AT                         TTCTTTGTGGCCAGGGACGAGCCGAACTTCCCTCTCCTTCAAATGACGGTGGGGCTTCTGCTGCTTGTGGGAGTTTCGGTCGCGATCTGGTGGTTCACCGATCCGGACAGGTCGAAAAAATAAaacagccggagcggactgccttcgacctcacttgcgcaaacgggacgatgcgcgcaatattgcgcaaatctgtcataacaccgtgaccctcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG4321 Uncharacterized protein related to arylsulfate sulfotransferase involved in siderophore biosynthesis ... can be seen here     ..................................................................................................................