Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:115 nt.    Distance to gene:83 nt.     Distance to run of Ts=1 nt.   Size=28 nt.     Delta G= -7.40 kcal/mol
Antiterminator:    Distance from promoter:57 nt. Size=74 nt.     Delta G=-29.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: GTGACA-TTTAGT. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGACAAGGGATGTCGCACCCTATTTAGTGGTGGGCGGCGTTCCGGCGCGGCTTATCC
GCAAACGGTTCAGCGATGCGGTGATCGCGCGCCTGCTTGCGCTTTCCTGGTGGGACTG
GCCTGTGGAAAAGCTCTATGAGGCTGTTCCCGATATTCAGGCGCTTGAGATCGAGGCG
TTTTTGGAAAAGTGGGGCGGATGAaatccacacttgcaaagccaggattacctgcccattttcgcaatcgataatgctggag
ataaatATG

    BR1414


Gene: BR1414     GI: 23502285     BI number: BR1414     GOG: COG3045     Description: conserved hypothetical protei


  A
A  G
A  C
 AT
 GC
 GT
 TA
 GT
|  G
 TA
 CG
 CG
 GC
 GT
T  G
C  T
 AT
 GC
 GC
 GC
 TG
G  A
G  |
T  |
C  |
C  |
T  |
T  |
T  |       CG
C  |      G  C
G  |       GT
C  |       AT
 GT        CG
 TA        TA
T  T       TG
C  T      A  |
 GC        TA
 TA        AT
 CG        GC
 CG        CG
 GC       |  A
 CG        CG
 GC        CG
            CGTTTTTGGAAAAGTGGGGCGGATGAaatccacacttgcaaagccaggattacctgcccattttcgcaatcgataatgctggagataaatATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[S] COG3045 Uncharacterized protein conserved in bacteria ... can be seen here

    ..................................................................................................................