                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:110 nt.     Distance to run of Ts=1 nt.   Size=35 nt.     Delta G=-12.40 kcal/mol
Antiterminator: Size=34 nt.     Delta G=-10.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cttatattgggatagattgcatacaaacgattttgttcCTATGGTCTGGCCGCATCCTGAAACCGCTCTAGATA
TGGAGCTGTCATGATCGCAACGCCGCGATGCGCATCATCTCGGCTGCGATTTTGACCG
GGAGGACATTTCAAATGCGAGGCTGCTTTCCGATTGAAATGCAGTTCGTACTTTTGTT
TGTGAAGTGAAACAATCGCCGCTTTTGATAATCCCCGTATGGGATAGACGGCTTGCAG
GCTGTTGCGGAACCGCCTGTTATCGGGAGTTTTCAGAATGAACAAtgcaggaATG

    BR1453 Gene: BR1453     GI: 23502322     BI number: BR1453     GOG: COG0477     Description: metabolite-proton symporte             A AT       G  T A  G      C  T A  C       CG CG        TA TA        TA TG        TA TG       |  T |  C       CG AT        GC CG        TA A  |       CG GC       G  | GT        GT AT        AT GT        GC GC        CG GC        GT CG        TA             CTTTTGTTTGTGAAGTGAAACAATCGCCGCTTTTGATAATCCCCGTATGGGATAGACGGCTTGCAGGCTGTTGCGGAACCGCCTGTTATCGGGAGTTTTCAGAATGAACAAtgcaggaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here     ..................................................................................................................