                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:154 nt.     Distance to run of Ts=3 nt.   Size=35 nt.     Delta G=-14.40 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -3.10 kcal/mol
Anti-antiterminator:   Size=65 nt.     Delta G=-15.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TACCAGGTTTTAAGGGCGCTAAGGTCGGCAAAAGTGGCGTCGTTAAGTCTAATCACGG
GCATCATggctctctccgctcaaggttgatagacagcatgttacatattctctcgttgaccgcaagagaatatgtaacatattttctaagcgcag
accttcgggccggactgctcgatgatttcgaaaactgtctgctacccttgccgccaacgcgggagcgggtgcgcacgaactaatggctcagtatggctgg
accaatctaaagcaggcagagatttacaccaagaacgctgacagggcATG

    BR1474 Gene: BR1474     GI: 23502343     BI number: BR1474     GOG: COG0582     Description: site-specific recombinase, phage integrase famil TC A  A A  C TG CG TG GC A  A A  T T  C TA GT Cg Tg Gc |  t |  c        a |  t      t  c        a |  c       ta       g  c C  t       gt       t  c Gc        ta        tg Gc        at        gc Tg       c  t      c  a Gc        gc        ta At        at        cg |  c      c  c       ta A  a       at        cg A  a       gc        ta A  g      a  |       ta Cg        tg        at Gt        at        ta Gt       g  t       at Cg       t  g       cg Ta        ta        at Gt        gc        ta                         acatattttctaagcgcagaccttcgggccggactgctcgatgatttcgaaaactgtctgctacccttgccgccaacgcgggagcgggtgcgcacgaactaatggctcagtatggctggaccaatctaaagcaggcagagatttacaccaagaacgctgacagggcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0582 Integrase ... can be seen here     ..................................................................................................................