                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:170 nt.     Distance to run of Ts=2 nt.   Size=16 nt.     Delta G= -8.10 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -6.30 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G= -4.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGGATGATGACGATTATCTCGACCACATGGTCACACCAGACAAAATTGCCCGGTAAa
tcttgttttaccaaacattgctaaaatttaatcctgtgccgggagcaggcgatcttatgatcgcagtttcttcagtatattgattttattgaatttttaa
tgatggagttcaatcggtaattgccgttggcgctgcatgtgaacgccagatgaacgggtctttgcctttccgttcatcatttggggactaactatcgggt
gtctcaggcgaaagcccgaaagcaaatcgaaagaggttcagaATG

    BR1476 Gene: BR1476     GI: 23502345     BI number: BR1476     GOG: NOG09767     Description: hypothetical protei tt c  g        g t  t      t  c at        gc At        tg At        cg Ta        cg Gc        ta Gc       a  g C  a      a  c C  a      t  a C  a      t  | Gc       t  | Ta       a  | T  |      a  | A  |      a  |       ta A  |      a  |      t  t At        tg        cg At        cg        ta Cg        gc        at A  |       tg        gc Gc        ta        cg At        at        gc                         agtttcttcagtatattgattttattgaatttttaatgatggagttcaatcggtaattgccgttggcgctgcatgtgaacgccagatgaacgggtctttgcctttccgttcatcatttggggactaactatcgggtgtctcaggcgaaagcccgaaagcaaatcgaaagaggttcagaATG     ..................................................................................................................