                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:34 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-14.90 kcal/mol
Antiterminator: Size=27 nt.     Delta G= -3.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AACCAGTTCGCTAATGACAATTGCTCACCATTCAAGGTCTTCGCCGAACTCACAGCAT
AAttgtgtccacagatcagtccgatctggtccagtcaaaaatttgcgacacagcctcaaggcctccatagctggaagtacaccttgaatcacgtttcaa
tcgacaacgcaccgttaacctcaagcgattgccctgctctaaatgtcgggagatattgcccatcctgtaatagtcaattataatggaatttctattataa
ttgactttttggggtgactatgtcgaactcagcagaaattggcATG

   ق --- BR1851 Gene: BR1852     GI: 23502705     BI number: BR1852     GOG: COG1396     Description: transcriptional regulator, Cro/CI family Gene: BR1853     GI: 23502706     BI number: BR1853     GOG: COG1296     Description: AzlC family protei             t           a  t   t       a  t g  c       gc a  a       gt ta        ta at        at at        at ta        ta gt        at ta        ta c  |       ta c  |       at ta        at at        cg cg        ta cg        gc             tttttggggtgactatgtcgaactcagcagaaattggcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1396 Predicted transcriptional regulators ... can be seen here [E] COG1296 Predicted branched-chain amino acid permease (azaleucine resistance) ... can be seen here     ..................................................................................................................