Gene putatively regulated by attenuation in B_suis_1330_II
Characteristics of the secondary structures
Terminator: Distance to gene:63 nt. Distance to run of Ts=3 nt. Size=19 nt. Delta G= -6.20 kcal/mol
Antiterminator: Size=43 nt. Delta G= -3.80 kcal/mol
Anti-antiterminator: Size=48 nt. Delta G=-14.60 kcal/mol
Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
CTGCCGCCGAAAAGCCGCCGAACGAAATAGGCTTTCAGGAGACGCGAAAGCTCTTCAA
GCAGCGTCCGGTAAGCCGCACTATTTCCATCCAGCGCCAACAACATCAGGGCCTTCAA
cctctcttcattagaacgggccagtctcgtttctcctgtcgtcttattcgcgatagggacgaaaaagattacatccgcatcccgagcgatcacatcggcg
tgaacgatgtaacctttttcccctatccagcgaaacccttcctgtcacgcgccgatggcgcccaagttcaacaggagtttcgttATG
BRA0020
Gene: BRA0020 GI: 23499787 BI number: BRA0020 GOG: NOG14731 Description: conserved hypothetical protei
a
t t
t t c
c c c c
tg t g
gc a a
cg cg
ta gc
gt c |
ta cg
cg ta
cg at
tg c c
| a a a
| c t c
cg ta
ta at t
ta gc g g
ta a g c a
g a a g g a
c | a | gc
ta a | cg
cg a | ta
ta gc at
gt cg cg
at at at
aacctttttcccctatccagcgaaacccttcctgtcacgcgccgatggcgcccaagttcaacaggagtttcgttATG
..................................................................................................................