                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:187 nt.     Distance to run of Ts=1 nt.   Size=33 nt.     Delta G= -9.80 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -9.90 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G=-13.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CATGTGATTTCCTGCCCTTCATATGGGCGATGAAGCCGACGCCGCACGCATCATGCTC
GTTGCGCGGATCATAAAGGCCTTGAGCCGGCGGAACACCCGCAGCCTTGGTTTTTCGC
GTCGTTCGGGTGGAAGCCGTCGTCGCAGCTTTGACCGCTTCGTTCTGTACGTTGTGAG
AAACCACATTCGATACAGATGGCGTCAAATGCGTCATcgtcattccctccgtttggccctcatgttgaggtgc
gcgatcagcatataccgagatggtgacaaccatcccgcaggtgtattcattctATG

    BRA0053 Gene: BRA0053     GI: 23499820     BI number: BRA0053     GOG: -------     Description: hypothetical protei   C T  A A  T                  C CG                 A  A GC         G       A  C C  T      A  G       GC A  C      A  C       GC CG       A  C       CG GT       T  T       GC C  T       AT       G  A CG        CG       C  | GC        TA       C  | CG       A  G      G  | A  |       GC       A  | GC        GC       G  | CG       |  G      T  | CG        CG       T  | G  A       GC       C  | A  |       CG        CG AT       G  G       GC GC        TA        GC TA        TA        AT AT        GC        AT                         GGTTTTTCGCGTCGTTCGGGTGGAAGCCGTCGTCGCAGCTTTGACCGCTTCGTTCTGTACGTTGTGAGAAACCACATTCGATACAGATGGCGTCAAATGCGTCATcgtcattccctccgtttggccctcatgttgaggtgcgcgatcagcatataccgagatggtgacaaccatcccgcaggtgtattcattctATG     ..................................................................................................................