                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:129 nt.     Distance to run of Ts=1 nt.   Size=36 nt.     Delta G=-13.77 kcal/mol
Antiterminator: Size=31 nt.     Delta G= -5.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGGCCGCGTCCTGAACAGGCGCGTGGATATCGAAATTTTACGCAAGTAAcctgcgaggccta
tcgcaaagacacgcattttctcaaaaatgccatccatgttctccggatcatgaagacctatagagcggttcctatttttacaaagccgtcggaaccgctc
tatttttctgtttttacgcattacgcatcgaagcgggatcagaattcagttctgtgggccgatttccccttataggggcttcacagttttgctggaaatg
ctctaggctgccataaattaccagcaaggcgggacggATG

    BRA0057 Gene: BRA0057     GI: 23499824     BI number: BRA0057     GOG: COG2845     Description: conserved hypothetical protei            ca   g       a  a t  a      t  a a  a      t  g cg       t  c ta       t  c a  |      t  g gc       a  t gc       t  c |  t       cg c  a       cg c  t       ta ta        ta cg        gc ta        gc tg        cg gc        gc tg        at             ctatttttctgtttttacgcattacgcatcgaagcgggatcagaattcagttctgtgggccgatttccccttataggggcttcacagttttgctggaaatgctctaggctgccataaattaccagcaaggcgggacggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2845 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................