                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:84 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G= -8.20 kcal/mol
Antiterminator: Size=68 nt.     Delta G=-22.56 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-15.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TATTCAGCGGATCATCCGGCGGCGGGGGTTCCGGCTCGGCGAAGGCGGGCGGGGAAAG
CAGTTATTCGGCTGGTGGCAACGCCATGTGGAGCCCGGCTTACCGGCAACACGTGCTC
GGCCAGTTCAACAGGGATTAGggccttacacgcggcggcttcgccgcagaatcccgatcttcgcggctacccatgtctggcacat
catgggcgacctttttgcaacgctaaagcgaaaatgaggcaccccggttttggtcgtactacggccgggaatgcttcatccgcaccgcaggtaatcataA
TG

    BRA0063 --- BRA0062 --- BRA0061 --- BRA0060 --- BRA0059 Gene: BRA0063     GI: 23499830     BI number: BRA0063     GOG: -------     Description: type IV secretion system protein VirB7 Gene: BRA0062     GI: 23499829     BI number: BRA0062     GOG: COG3736     Description: type IV secretion system protein VirB8 Gene: BRA0061     GI: 23499828     BI number: BRA0061     GOG: COG3504     Description: type IV secretion system protein VirB9 Gene: BRA0060     GI: 23499827     BI number: BRA0060     GOG: COG2948     Description: type IV secretion system protein VirB10 Gene: BRA0059     GI: 23499826     BI number: BRA0059     GOG: COG0630     Description: type IV secretion system protein VirB1            ct           g  t            gc            cg            gc            gc            cg            gc           c  a           a  g   C       c  | A  A      a  | A  G      t  | CG       t  | TG       c  | TA       c  | GT       g  | |  T      g  | |  A      G  | A  G      A  | Cg        Ta Cg        Ta Gc        At Gc        Gc C  t       Gc        gc T  t       Gc       g  a C  a      |  g      t  c Gc       A  a      c  a Ta       C  t      t  t Gc       A  c       gc Cg       A  t       ta A  c      C  t       at C  g      T  c       cg A  |       Tg        cg A  |       Gc        cg Cg       A  |      a  c Gc        Cg       t  g G  |       Cg       c  a Cg        Gc        gc Cg        Gt        gc                         tttttgcaacgctaaagcgaaaatgaggcaccccggttttggtcgtactacggccgggaatgcttcatccgcaccgcaggtaatcataATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [U] COG3736 Type IV secretory pathway, component VirB8 ... can be seen here [U] COG3504 Type IV secretory pathway, VirB9 components ... can be seen here [U] COG2948 Type IV secretory pathway, VirB10 components ... can be seen here [NU] COG0630 Type IV secretory pathway, VirB11 components, and related ATPases involved in archaeal flagella biosynthesis ... can be seen here     ..................................................................................................................