                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:101 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-10.40 kcal/mol
Antiterminator: Size=20 nt.     Delta G= -5.50 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G= -9.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ctttatgggtttctaaagcatgcaggttagcatttagtttaccatggcacggcgattgacaaaatcgccggccgagccatgaatggggggccggaggagc
acaaagaagtaaatttggatcaacacccttgagggaaagacatttaatgtgatggccccggtggcctaatttcgccattcggtaacgaaatggccttatt
tgcaaaccagtggcttggccagtagtttggcgagtagtttggccaatgggcttggccaataacttggggtgcaattcatgaatgaaaatcgaggagagga
ATG

    galU Gene: galU     GI: 23499838     BI number: BRA0071     GOG: COG1210     Description: UTP--glucose-1-phosphate uridylyltransferas at a  g t  t tg ta at cg a  g g  | a  | a  | a  | gc                  tt gc                 a  c gc                  cg a  c                 cg g  |                |  t t  |                |  a t  |                |  a c  |                 gc cg                  cg cg        at        ta at       a  t       ta cg       t  t       ta a  g      c  c       at a  |       cg       a  | c  |       gc       t  | t  |       gc        cg a  |       ta        cg gc        gt        gc gc        gt        gc                         ttatttgcaaaccagtggcttggccagtagtttggcgagtagtttggccaatgggcttggccaataacttggggtgcaattcatgaatgaaaatcgaggagaggaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG1210 UDP-glucose pyrophosphorylase ... can be seen here     ..................................................................................................................