                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:178 nt.     Distance to run of Ts=1 nt.   Size=24 nt.     Delta G= -7.70 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -9.70 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G= -9.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCTTTAGAGCCTATGGCAAAAAGTAGagaatgtgttccgaagtgaaacacatttaggattttttcgatcacgaaatagt
gaaaatcgttaggatcggggtttttccaacctcgtcatattttgacctgttattgtgtgcaaagggttgcaattaagtaattgccggttgccaacgacta
tattttttttaagtcactaataagcgattgaaggcctctgaggggaggcgattctctcgcaagcagttatagagataccagagcgaagcccgcatggttt
catcaccaaggatatttccaATG

    BRA0119 Gene: BRA0119     GI: 23499883     BI number: BRA0119     GOG: COG2771     Description: transcriptional regulator, LuxR famil   a a  g gt cg        aa c  a      a  t ta       g  a ta        cg gc        at ta        cg gc        ta ta       |  a at       |  a        t at       |  a      t  c gt        at       t  c a  a       gc        ta G  g       cg        ta A  g      t  t       gc Ta       t  t       gc Gt        ta        gt At        tg        gc At        tg        cg At        ta       t  | At        at        at At        gc        gc                         atattttgacctgttattgtgtgcaaagggttgcaattaagtaattgccggttgccaacgactatattttttttaagtcactaataagcgattgaaggcctctgaggggaggcgattctctcgcaagcagttatagagataccagagcgaagcccgcatggtttcatcaccaaggatatttccaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG2771 DNA-binding HTH domain-containing proteins ... can be seen here     ..................................................................................................................