                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:48 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -6.30 kcal/mol
Antiterminator: Size=67 nt.     Delta G=-14.00 kcal/mol
Anti-antiterminator:   Size=23 nt.     Delta G= -5.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GATCGGCAAGCTGGCGCGTGGCGAAAGGGGCCGCTATGGCGTGTTCCAGAGAGACGAC
CGTTATCCCGTCGAGAGGGCGGAGGGCGCTTTCTGGCGGCTGGACTGAGAAGGGTGCA
GTCATGGCGTATATGCTCCGGCTTGAAAATTTGAATGATGAAAATCTAAAATATTTTC
AGCAAAAGCGCGAAGCGGTGTTCGGCTTCCATTTGACGAATTAAACCTTGACCGCGTG
CGGATGACCATGCGCATttttaaaaggaagccttcgctaaaattgaaggctggtccaggagactgtccATG

    BRA0163 Gene: BRA0163     GI: 23499925     BI number: BRA0163     GOG: COG0583     Description: transcriptional regulator, LysR famil            CA           C  T           T  T           T  T           C  G           G  A            GC            CG            TA            TA            GT           |  T           |  A           |  A           |  A           |  C           |  C           |  T           |  T           |  G            TA            GC            GC            CG            GC           A  |           A  |           G  |            CG GG        GT C  T       CG G  G       GC        TG AT       A  G      A  A AT       A  G       GC GC       A  A       GC CG       A  |      C  A G  |      C  |      G  T CG       G  |       TG GC        AT        GC AT        CG        CG AT        TA        GC                         ATttttaaaaggaagccttcgctaaaattgaaggctggtccaggagactgtccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0583 Transcriptional regulator ... can be seen here     ..................................................................................................................